Structure of human telomeric dna in crowded solution
PDB DOI: 10.2210/pdb2ld8/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2011-05-17 Deposition Author(s): Heddi, B. , Phan, A.T.
Method: SOLUTION NMR Resolution: N.A.
Structure of human telomeric dna in crowded solution
Primary Citation of Related Structures: 2LD8
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| Human Telomeric DNA | a | 23 | NA | TAGGGTTAGGGTTAGGGTTAGGG |
Method: SOLUTION NMR
Deposited Date: 2011-05-17 Deposition Author(s): Heddi, B. , Phan, A.T.