Nmr model of the first let-7 mirna complementary site (lcs1) in 3'-utr of lin-41 mrna from c. elegans
PDB DOI: 10.2210/pdb2kpv/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2009-10-20 Deposition Author(s): Cevec, M. , Plavec, J. , Thibaudeau, C.
Nmr model of the first let-7 mirna complementary site (lcs1) in 3'-utr of lin-41 mrna from c. elegans
Cevec, M. , Plavec, J. , Thibaudeau, C.
Primary Citation of Related Structures: 2KPV
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| RNA (34-MER) | a | 34 | NA | GGAGGUAGUAGGUCGAAAGACCGUUCUACACUCC |
Method: SOLUTION NMR
Deposited Date: 2009-10-20 Deposition Author(s): Cevec, M. , Plavec, J. , Thibaudeau, C.