High resolution nmr solution structure of a complex of hiv-2 tar rna and a synthetic tripeptide in a 1:2 stoichiometry
PDB DOI: 10.2210/pdb2kmj/pdb
Classification: RNA/PEPTIDE Organism(s): Human Immunodeficiency Virus 2 , Synthetic Construct
Deposited: 2009-07-30 Deposition Author(s): Breitung, S. , Ferner, J. , Goebel, M. , Hennig, M. , Jonker, H.R.A. , Schwalbe, H. , Suhartono, M. , Woehnert, J.
Method: SOLUTION NMR Resolution: N.A.
High resolution nmr solution structure of a complex of hiv-2 tar rna and a synthetic tripeptide in a 1:2 stoichiometry
Breitung, S. , Ferner, J. , Goebel, M. , Hennig, M. , Jonker, H.R.A. , Schwalbe, H. , Suhartono, M. , Woehnert, J.
Primary Citation of Related Structures: 2KMJ
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| RNA (28-MER) | a | 28 | NA | GGCCAGAUUGAGCUUCGGCUCUCUGGUC |
| Proteins | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| Pyrimidinylpeptide | B | 4 | Human Immunodeficiency Virus 2 , Synthetic Construct | RXRX |
| Pyrimidinylpeptide | C | 4 | Human Immunodeficiency Virus 2 , Synthetic Construct | RXRX |
Method: SOLUTION NMR
Deposited Date: 2009-07-30 Deposition Author(s): Breitung, S. , Ferner, J. , Goebel, M. , Hennig, M. , Jonker, H.R.A. , Schwalbe, H. , Suhartono, M. , Woehnert, J.