2JUK
Guanidino neomycin b recognition of an hiv-1 rna helix
PDB DOI: 10.2210/pdb2juk/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2007-08-30 Deposition Author(s): Butcher, S.E. , Elson-Schwab, L. , Niccolai, N. , Staple, D.W. , Tor, Y. , Venditti, V.
Experimental Data Snapshot
Method: SOLUTION NMR Resolution: N.A.
Guanidino neomycin b recognition of an hiv-1 rna helix
Butcher, S.E. , Elson-Schwab, L. , Niccolai, N. , Staple, D.W. , Tor, Y. , Venditti, V.
Primary Citation of Related Structures: 2JUK
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| HIV-1 frameshift site RNA | a | 22 | NA | GGCCUUCCCACAAGGGAAGGCC |
Experimental Data
Method: SOLUTION NMR
Deposited Date: 2007-08-30 Deposition Author(s): Butcher, S.E. , Elson-Schwab, L. , Niccolai, N. , Staple, D.W. , Tor, Y. , Venditti, V.