Monomeric human telomere dna tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, 16 g form 1, nmr, 10 structures
PDB DOI: 10.2210/pdb2jsk/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2007-07-07 Deposition Author(s): Kuryavyi, V.V. , Luu, K.N. , Patel, D.J. , Phan, A.T.
Method: SOLUTION NMR Resolution: N.A.
Monomeric human telomere dna tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, 16 g form 1, nmr, 10 structures
Kuryavyi, V.V. , Luu, K.N. , Patel, D.J. , Phan, A.T.
Primary Citation of Related Structures: 2JSK
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| HUMAN TELOMERE DNA | a | 23 | NA | TAGGGTTAGGGTTAGGGTTAGGG |
Method: SOLUTION NMR
Deposited Date: 2007-07-07 Deposition Author(s): Kuryavyi, V.V. , Luu, K.N. , Patel, D.J. , Phan, A.T.