Human telomere dna quadruplex structure in k+ solution hybrid-2 form
PDB DOI: 10.2210/pdb2jpz/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2007-05-25 Deposition Author(s): Carver, M. , Dai, J. , Jones, R. , Punchihewa, C. , Yang, D.
Human telomere dna quadruplex structure in k+ solution hybrid-2 form
Carver, M. , Dai, J. , Jones, R. , Punchihewa, C. , Yang, D.
Primary Citation of Related Structures: 2JPZ
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| DNA (26-MER) | a | 26 | NA | TTAGGGTTAGGGTTAGGGTTAGGGTT |
Method: SOLUTION NMR
Deposited Date: 2007-05-25 Deposition Author(s): Carver, M. , Dai, J. , Jones, R. , Punchihewa, C. , Yang, D.