Structure of the aagu tetraloop
PDB DOI: 10.2210/pdb2hns/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2006-07-13 Deposition Author(s): Fourmy, F. , Gaudin, C. , Yoshizawa, S.
Structure of the aagu tetraloop
Fourmy, F. , Gaudin, C. , Yoshizawa, S.
Primary Citation of Related Structures: 2HNS
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| 5'-R(*GP*GP*CP*GP*UP*GP*AP*UP*CP*AP*AP*GP*UP*GP*AP*UP*CP*GP*CP*GP*CP*C)-3' | a | 22 | NA | GGCGUGAUCAAGUGAUCGCGCC |
Method: SOLUTION NMR
Deposited Date: 2006-07-13 Deposition Author(s): Fourmy, F. , Gaudin, C. , Yoshizawa, S.