Modified pyrimidines specifically bind the purine riboswitch
PDB DOI: 10.2210/pdb2g9c/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2006-03-06 Deposition Author(s): Batey, R.T. , Gilbert, S.D. , Mediatore, S.J.
Modified pyrimidines specifically bind the purine riboswitch
Batey, R.T. , Gilbert, S.D. , Mediatore, S.J.
Primary Citation of Related Structures: 2G9C
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| guanine riboswitch | a | 67 | NA | GGACAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGAUUAUGUCC |
Method: X-RAY DIFFRACTION
Deposited Date: 2006-03-06 Deposition Author(s): Batey, R.T. , Gilbert, S.D. , Mediatore, S.J.