Solution structure of the c27a scylv p1-p2 frameshifting pseudoknot, average structure
PDB DOI: 10.2210/pdb2ap5/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2005-08-15 Deposition Author(s): Cornish, P.V. , Giedroc, D.P.
Method: SOLUTION NMR Resolution: N.A.
Solution structure of the c27a scylv p1-p2 frameshifting pseudoknot, average structure
Primary Citation of Related Structures: 2AP5
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| C27A Sugarcane Yellow Leaf Virus RNA pseudoknot | a | 28 | NA | AGUGGCGCCGACCACUUAAAAACAACGG |
Method: SOLUTION NMR
Deposited Date: 2005-08-15 Deposition Author(s): Cornish, P.V. , Giedroc, D.P.