PDBi (Protein Data Bank in India)

All in One Protein Databank
Home About Help Resources External Links Contact Us
Advanced Search
FASTA Sequence PDB Format mmCIF Format
FASTA Sequence PDB Format PDB Format(gz) PDBx/mmCIF Format PDBx/mmCIF Format(gz) PDBML/XML Format Validation Full PDF Validation CIF

1YRJ

Crystal structure of apramycin bound to a ribosomal rna a site oligonucleotide

PDB DOI: 10.2210/pdb1yrj/pdb

Classification: RNA
Organism(s): N.A.

Deposited: 2005-02-03
Deposition Author(s): Fish, S. , Froelich, J.M. , Han, Q. , Hermann, T. , Simonsen, K.B. , Vourloumis, D. , Wall, D. , Zhao, Q.

Experimental Data Snapshot

Method: X-RAY DIFFRACTION
Resolution: 2.7 Å

1yrj
Literature

Crystal structure of apramycin bound to a ribosomal rna a site oligonucleotide

Fish, S. , Froelich, J.M. , Han, Q. , Hermann, T. , Simonsen, K.B. , Vourloumis, D. , Wall, D. , Zhao, Q.

Primary Citation of Related Structures: 1YRJ


Nucleic Acids / Hybrid
Molecule Chains Sequence Length Organism Sequence
Bacterial 16 S Ribosomal RNA A Site Oligonucleotide a 23 NA UUGCGUCACACCGGUGAAGUCGC
Bacterial 16 S Ribosomal RNA A Site Oligonucleotide b 23 NA UUGCGUCACACCGGUGAAGUCGC
Experimental Data

Method: X-RAY DIFFRACTION

Deposited Date: 2005-02-03
Deposition Author(s): Fish, S. , Froelich, J.M. , Han, Q. , Hermann, T. , Simonsen, K.B. , Vourloumis, D. , Wall, D. , Zhao, Q.