Interaction of era,a gtpase protein, with the 3'minor domain of the 16s rrna within the thermus thermophilus 30s subunit.
PDB DOI: 10.2210/pdb1x1l/pdb
Classification: STRUCTURAL PROTEIN/RNA Organism(s): Escherichia Coli , Thermus Thermophilus
Deposited: 2005-04-06 Deposition Author(s): Agrawal, R.K. , Barat, C. , Sharma, M.R.
Interaction of era,a gtpase protein, with the 3'minor domain of the 16s rrna within the thermus thermophilus 30s subunit.
Agrawal, R.K. , Barat, C. , Sharma, M.R.
Primary Citation of Related Structures: 1X1L
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| RNA (130-MER) | a | 130 | NA | CGCCCGUCACGCCAUGGGAGCGGGCUCUACCCGAAGUCGCCGGGAGCCUACGGGCAGGCGCCGAGGGUAGGGCCCGUGACUGGGGCGAAGUCGUAACAAGGUAGCUGUACCGGAAGGUGCGGCUGGAUCA |
| Proteins | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| GTP-binding protein era | X | 301 | Escherichia Coli , Thermus Thermophilus | MSIDKSYCGFIAIVGRPNVGKSTLLNKLLGQKISITSRKAQTTRHRIVGIHTEGAYQAIYVDTPGLHMEEKRAINRLMNKAASSSIGDVELVIFVVEGTRWTPDDEMVLNKLREGKAPVILAVNKVDNVQEKADLLPHLQFLASQMNFLDIVPISAETGLNVDTIAAIVRKHLPEATHHFPEDYITDRSQRFMASEIIREKLMRFLGAELPYSVTVEIERFVSNERGGYDINGLILVEREGQKKMVIGNKGAKIKTIGIEARKDMQEMFEAPVHLELWVKVKSGWADDERALRSLGYVDDL |
Method: ELECTRON MICROSCOPY
Deposited Date: 2005-04-06 Deposition Author(s): Agrawal, R.K. , Barat, C. , Sharma, M.R.