Solution structure of the active site stem-loop of the vs ribozyme
PDB DOI: 10.2210/pdb1tjz/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2004-06-07 Deposition Author(s): Dieckmann, T. , Flinders, J.
Method: SOLUTION NMR Resolution: N.A.
Solution structure of the active site stem-loop of the vs ribozyme
Primary Citation of Related Structures: 1TJZ
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| VS Ribozyme | a | 22 | NA | GGUGACGCCGUAAGGCGCAGCC |
Method: SOLUTION NMR
Deposited Date: 2004-06-07 Deposition Author(s): Dieckmann, T. , Flinders, J.