Average solution structure of a pseudo-5'-splice site from the negative regulator of splicing of rous sarcoma virus
PDB DOI: 10.2210/pdb1s2f/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2004-01-08 Deposition Author(s): Beemon, K.L. , Cabello-Villegas, J. , Giles, K.E. , Soto, A.M. , Wang, Y.X. , Yu, P.
Average solution structure of a pseudo-5'-splice site from the negative regulator of splicing of rous sarcoma virus
Beemon, K.L. , Cabello-Villegas, J. , Giles, K.E. , Soto, A.M. , Wang, Y.X. , Yu, P.
Primary Citation of Related Structures: 1S2F
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| 5'-R(*GP*GP*GP*GP*AP*GP*UP*GP*GP*UP*UP*UP*GP*UP*AP*UP*CP*CP*UP*UP*CP*CP*C)-3' | a | 23 | NA | GGGGAGUGGUUUGUAUCCUUCCC |
Method: SOLUTION NMR
Deposited Date: 2004-01-08 Deposition Author(s): Beemon, K.L. , Cabello-Villegas, J. , Giles, K.E. , Soto, A.M. , Wang, Y.X. , Yu, P.