Nmr structure of 5'-r(ggaugccucccgagugcaucc): an rna hairpin derived from the mouse 5'ets that binds nucleolin rbd12.
PDB DOI: 10.2210/pdb1qwa/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2003-09-01 Deposition Author(s): Feigon, J. , Finger, L.D. , Johansson, C. , Trantirek, L.
Method: SOLUTION NMR Resolution: N.A.
Nmr structure of 5'-r(ggaugccucccgagugcaucc): an rna hairpin derived from the mouse 5'ets that binds nucleolin rbd12.
Feigon, J. , Finger, L.D. , Johansson, C. , Trantirek, L.
Primary Citation of Related Structures: 1QWA
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| 18S ribosomal RNA, 5'ETS | a | 21 | NA | GGAUGCCUCCCGAGUGCAUCC |
Method: SOLUTION NMR
Deposited Date: 2003-09-01 Deposition Author(s): Feigon, J. , Finger, L.D. , Johansson, C. , Trantirek, L.