Crystal structure of the sarcin/ricin domain from e.coli 23s rrna at 1.04 resolution
PDB DOI: 10.2210/pdb1q9a/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2003-08-22 Deposition Author(s): Beneken, J. , Chan, Y.L. , Correll, C.C. , Lubbers, M. , Plantinga, M.J.
Crystal structure of the sarcin/ricin domain from e.coli 23s rrna at 1.04 resolution
Beneken, J. , Chan, Y.L. , Correll, C.C. , Lubbers, M. , Plantinga, M.J.
Primary Citation of Related Structures: 1Q9A
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| Sarcin/ricin 23S rRNA | a | 27 | NA | UGCUCCUAGUACGAGAGGACCGGAGUG |
Method: X-RAY DIFFRACTION
Deposited Date: 2003-08-22 Deposition Author(s): Beneken, J. , Chan, Y.L. , Correll, C.C. , Lubbers, M. , Plantinga, M.J.