Solution structure of the hiv-1 frameshift inducing stem-loop rna
PDB DOI: 10.2210/pdb1pjy/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2003-06-04 Deposition Author(s): Butcher, S.E. , Staple, D.W.
Method: SOLUTION NMR Resolution: N.A.
Solution structure of the hiv-1 frameshift inducing stem-loop rna
Primary Citation of Related Structures: 1PJY
Nucleic Acids / Hybrid | ||||
---|---|---|---|---|
Molecule | Chains | Sequence Length | Organism | Sequence |
HIV-1 frameshift inducing stem-loop | a | 22 | NA | GGCCUUCCCACAAGGGAAGGCC |
Method: SOLUTION NMR
Deposited Date: 2003-06-04 Deposition Author(s): Butcher, S.E. , Staple, D.W.