1OW9
Nmr structure of the active conformation of the vs ribozyme cleavage site
PDB DOI: 10.2210/pdb1ow9/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2003-03-28 Deposition Author(s): Andersen, A.A. , Collins, R.A. , Gendron, P. , Hoffmann, B. , Legault, P. , Major, F. , Mitchell, G.T.
Experimental Data Snapshot
Method: SOLUTION NMR Resolution: N.A.
Nmr structure of the active conformation of the vs ribozyme cleavage site
Andersen, A.A. , Collins, R.A. , Gendron, P. , Hoffmann, B. , Legault, P. , Major, F. , Mitchell, G.T.
Primary Citation of Related Structures: 1OW9
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| A mimic of the VS Ribozyme Hairpin Substrate | a | 23 | NA | GAGCGAAGACGAAAGUCGAGCUC |
Experimental Data
Method: SOLUTION NMR
Deposited Date: 2003-03-28 Deposition Author(s): Andersen, A.A. , Collins, R.A. , Gendron, P. , Hoffmann, B. , Legault, P. , Major, F. , Mitchell, G.T.