1NA2
Solution structure of the p2b hairpin from human telomerase rna
PDB DOI: 10.2210/pdb1na2/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2002-11-26 Deposition Author(s): Feigon, J. , Finger, L.D. , Theimer, C.A. , Trantirek, L.
Experimental Data Snapshot
Method: SOLUTION NMR Resolution: N.A.
Solution structure of the p2b hairpin from human telomerase rna
Feigon, J. , Finger, L.D. , Theimer, C.A. , Trantirek, L.
Primary Citation of Related Structures: 1NA2
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| telomerase RNA p2b hairpin | a | 30 | NA | GGGCUGUUUUUCUCGCUGACUUUCAGCCCC |
Experimental Data
Method: SOLUTION NMR
Deposited Date: 2002-11-26 Deposition Author(s): Feigon, J. , Finger, L.D. , Theimer, C.A. , Trantirek, L.