1N66
Structure of the pyrimidine-rich internal loop in the y-domain of poliovirus 3'utr
PDB DOI: 10.2210/pdb1n66/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2002-11-08 Deposition Author(s): Heus, H.A. , Hilbers, C.W. , Lescrinier, E.M. , Melchers, W.J. , Tessari, M. , Van Kuppeveld, F.J.
Experimental Data Snapshot
Method: SOLUTION NMR Resolution: N.A.
Structure of the pyrimidine-rich internal loop in the y-domain of poliovirus 3'utr
Heus, H.A. , Hilbers, C.W. , Lescrinier, E.M. , Melchers, W.J. , Tessari, M. , Van Kuppeveld, F.J.
Primary Citation of Related Structures: 1N66
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| internal loop in the Y-domain of poliovirus 3'UTR | a | 22 | NA | GGACCUCUCGAAAGAGUUGUCC |
Experimental Data
Method: SOLUTION NMR
Deposited Date: 2002-11-08 Deposition Author(s): Heus, H.A. , Hilbers, C.W. , Lescrinier, E.M. , Melchers, W.J. , Tessari, M. , Van Kuppeveld, F.J.