Structure of 23s ribosomal rna hairpin 35
PDB DOI: 10.2210/pdb1mt4/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2002-09-20 Deposition Author(s): Douthwaite, S. , Fourmy, D. , Guittet, E. , Lebars, I. , Stenholm, A.R. , Yoshizawa, S.
Method: SOLUTION NMR Resolution: N.A.
Structure of 23s ribosomal rna hairpin 35
Douthwaite, S. , Fourmy, D. , Guittet, E. , Lebars, I. , Stenholm, A.R. , Yoshizawa, S.
Primary Citation of Related Structures: 1MT4
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| 23S ribosomal Hairpin 35 | a | 24 | NA | GGCGUAACGUUGAAAAGUUACGCC |
Method: SOLUTION NMR
Deposited Date: 2002-09-20 Deposition Author(s): Douthwaite, S. , Fourmy, D. , Guittet, E. , Lebars, I. , Stenholm, A.R. , Yoshizawa, S.