Structure of the histone mrna hairpin required for cell cycle regulation of histone gene expression
PDB DOI: 10.2210/pdb1kks/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2001-12-10 Deposition Author(s): Crombie, C. , Linge, J.P. , Luyten, I. , Muller, B. , Nilges, M. , Sattler, M. , Schuemperli, D. , Zanier, K.
Structure of the histone mrna hairpin required for cell cycle regulation of histone gene expression
Crombie, C. , Linge, J.P. , Luyten, I. , Muller, B. , Nilges, M. , Sattler, M. , Schuemperli, D. , Zanier, K.
Primary Citation of Related Structures: 1KKS
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| 5'-R(*GP*GP*AP*AP*GP*GP*CP*CP*CP*UP*UP*UP*UP*CP*AP*GP*GP*GP*CP*CP*AP*CP*CP*C)-3' | a | 24 | NA | GGAAGGCCCUUUUCAGGGCCACCC |
Method: SOLUTION NMR
Deposited Date: 2001-12-10 Deposition Author(s): Crombie, C. , Linge, J.P. , Luyten, I. , Muller, B. , Nilges, M. , Sattler, M. , Schuemperli, D. , Zanier, K.