Solution structure of influenza a virus promoter
PDB DOI: 10.2210/pdb1jo7/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2001-07-27 Deposition Author(s): Bae, S.-H. , Cheong, C. , Cheong, H.-K. , Choi, B.-S. , Kainosho, M. , Lee, J.-H.
Solution structure of influenza a virus promoter
Bae, S.-H. , Cheong, C. , Cheong, H.-K. , Choi, B.-S. , Kainosho, M. , Lee, J.-H.
Primary Citation of Related Structures: 1JO7
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| Influenza A virus promoter RNA | a | 31 | NA | AGUAGAAACAAGGCUUCGGCCUGCUUUUGCU |
Method: SOLUTION NMR
Deposited Date: 2001-07-27 Deposition Author(s): Bae, S.-H. , Cheong, C. , Cheong, H.-K. , Choi, B.-S. , Kainosho, M. , Lee, J.-H.