>8vkv_6 mol:na length:38 T DNA ops
CCCTGTCTGGCGTCCTCTCACCCCTATGATCATGACGG