Search Query :
5DML
Crystal structure of the homocysteine methyltransferase mmum from escherichia coli, oxidized form Deposition Author(s): Andrew, H.D. , Bradbury, L.M.T. , Bruner, S.D. , Li, G. , Li, K.
Date: 2015-09-09 Method: X-RAY DIFFRACTION Resolution: 2.452 Å Organism(s): Escherichia Coli (Strain K12) Sequences Data: 5DML_A
5DMM
Crystal structure of the homocysteine methyltransferase mmum from escherichia coli, metallated form Deposition Author(s): Andrew, H.D. , Bradbury, L.M.T. , Bruner, S.D. , Li, G. , Li, K.
Date: 2015-09-09 Method: X-RAY DIFFRACTION Resolution: 1.779 Å Organism(s): Escherichia Coli (Strain K12) Sequences Data: 5DMM_A
5DMN
Crystal structure of the homocysteine methyltransferase mmum from escherichia coli, apo form Deposition Author(s): Andrew, H.D. , Bradbury, L.M.T. , Bruner, S.D. , Li, G. , Li, K.
Date: 2015-09-09 Method: X-RAY DIFFRACTION Resolution: 2.892 Å Organism(s): Escherichia Coli (Strain K12) Sequences Data: 5DMN_A , 5DMN_B
5DS4
Crystal structure the escherichia coli cas1-cas2 complex bound to protospacer dna Deposition Author(s): Doudna, J.A. , Engelman, A.N. , Harrington, L.B. , Kranzusch, P.J. , Nunez, J.K.
Date: 2015-09-16 Method: X-RAY DIFFRACTION Resolution: 3.2 Å Organism(s): Escherichia Coli (Strain K12) , Synthetic Construct Sequences Data: 5DS4_A , 5DS4_B , 5DS4_C , 5DS4_D , 5DS4_E , 5DS4_F , 5DS4_G , 5DS4_H
5DS5
Crystal structure the escherichia coli cas1-cas2 complex bound to protospacer dna and mg Deposition Author(s): Doudna, J.A. , Engelman, A.N. , Harrington, L.B. , Kranzusch, P.J. , Nunez, J.K.
Date: 2015-09-16 Method: X-RAY DIFFRACTION Resolution: 2.951 Å Organism(s): Escherichia Coli (Strain K12) , Synthetic Construct Sequences Data: 5DS5_A , 5DS5_B , 5DS5_C , 5DS5_D , 5DS5_E , 5DS5_F , 5DS5_G , 5DS5_H
5DS6
Crystal structure the escherichia coli cas1-cas2 complex bound to protospacer dna with splayed ends Deposition Author(s): Doudna, J.A. , Engelman, A.N. , Harrington, L.B. , Kranzusch, P.J. , Nunez, J.K.
Date: 2015-09-16 Method: X-RAY DIFFRACTION Resolution: 3.352 Å Organism(s): Escherichia Coli (Strain K12) , Synthetic Construct Sequences Data: 5DS6_A , 5DS6_B , 5DS6_C , 5DS6_D , 5DS6_E , 5DS6_F , 5DS6_G , 5DS6_H
5DS9
Crystal structure of fis bound to 27bp dna f1-8a (aaattagtttgaattttgagctaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2015-09-17 Method: X-RAY DIFFRACTION Resolution: 2.561 Å Organism(s): Escherichia Coli (Strain K12) , Synthetic Construct Sequences Data: 5DS9_A , 5DS9_B , 5DS9_C , 5DS9_D
5DUD
Crystal structure of e. coli ybgjk Deposition Author(s): Arbing, M.A. , Cascio, D. , Eisenberg, D. , Kaufmann, M. , Medrano-Soto, A. , Shin, A.
Date: 2015-09-18 Method: X-RAY DIFFRACTION Resolution: 2.8 Å Organism(s): Escherichia Coli (Strain K12) Sequences Data: 5DUD_A , 5DUD_C , 5DUD_B , 5DUD_D
5EKQ
The structure of the bamacde subcomplex from e. coli Deposition Author(s): Bakelar, J. , Buchanan, S.K. , Noinaj, N.
Date: 2015-11-04 Method: X-RAY DIFFRACTION Resolution: 3.392 Å Organism(s): Escherichia Coli (Strain K12) Sequences Data: 5EKQ_A , 5EKQ_D , 5EKQ_C , 5EKQ_E
5EN5
Apo structure of bacterial efflux pump. Deposition Author(s): Ornik, A.R. , Pos, K.M. , Sjuts, H.
Date: 2015-11-09 Method: X-RAY DIFFRACTION Resolution: 2.3 Å Organism(s): Escherichia Coli (Strain K12) , Ribosome Display Vector Prdv Sequences Data: 5EN5_A , 5EN5_B , 5EN5_C , 5EN5_D , 5EN5_E , 5EN5_F