Structure effects of the four-adenine loop of the coliphage ga replicase rna operator
PDB DOI: 10.2210/pdb5uf3/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2017-01-03 Deposition Author(s): Chang, A.T. , Dejong, E. , Nikonowicz, E.P. , Tran, M.
Structure effects of the four-adenine loop of the coliphage ga replicase rna operator
Chang, A.T. , Dejong, E. , Nikonowicz, E.P. , Tran, M.
Primary Citation of Related Structures: 5UF3
Nucleic Acids / Hybrid | ||||
---|---|---|---|---|
Molecule | Chains | Sequence Length | Organism | Sequence |
phage GA operator RNA hairpin | a | 23 | NA | GGACAUAAGGAAAACCUAUGUCC |
Method: SOLUTION NMR
Deposited Date: 2017-01-03 Deposition Author(s): Chang, A.T. , Dejong, E. , Nikonowicz, E.P. , Tran, M.