Structure of the thf riboswitch
PDB DOI: 10.2210/pdb4lvv/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2013-07-26 Deposition Author(s): Batey, R.T. , Trausch, J.J.
Structure of the thf riboswitch
Primary Citation of Related Structures: 4LVV
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| THF riboswitch | a | 89 | NA | GGAGAGUAGAUGAUUCGCGUUAAGUGUGUGUGAAUGGGAUGUCGUCACACAACGAAGCGAGAGCGCGGUGAAUCAUUGCAUCCGCUCCA |
Method: X-RAY DIFFRACTION
Deposited Date: 2013-07-26 Deposition Author(s): Batey, R.T. , Trausch, J.J.