Crystal structure of the a24u/u25a/a46g mutant xpt-pbux guanine riboswitch aptamer domain in complex with hypoxanthine
PDB DOI: 10.2210/pdb4fen/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2012-05-30 Deposition Author(s): Batey, R.T. , Knight, R. , Marcano, J. , Stoddard, C.D. , Trausch, J.J. , Widmann, J.
Method: X-RAY DIFFRACTION Resolution: 1.35 Å
Crystal structure of the a24u/u25a/a46g mutant xpt-pbux guanine riboswitch aptamer domain in complex with hypoxanthine
Batey, R.T. , Knight, R. , Marcano, J. , Stoddard, C.D. , Trausch, J.J. , Widmann, J.
Primary Citation of Related Structures: 4FEN
Nucleic Acids / Hybrid | ||||
---|---|---|---|---|
Molecule | Chains | Sequence Length | Organism | Sequence |
A24U/U25A/A46G mutant of the B. subtilis xpt-pbuX guanine riboswitch aptamer domain | b | 67 | NA | GGACAUAUAUACGCGUGGAUAUGGCACGCGAGUUUCUACCGGGCACCGUAAAUGUCCGACUAUGUCC |
Method: X-RAY DIFFRACTION
Deposited Date: 2012-05-30 Deposition Author(s): Batey, R.T. , Knight, R. , Marcano, J. , Stoddard, C.D. , Trausch, J.J. , Widmann, J.