3T5E
Crystal structure of an intramolecular human telomeric dna g-quadruplex bound by the naphthalene diimide bmsg-sh-4
PDB DOI: 10.2210/pdb3t5e/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2011-07-27 Deposition Author(s): Collie, G.W. , Parkinson, G.N. , Promontorio, R.
Experimental Data Snapshot
Method: X-RAY DIFFRACTION Resolution: 2.1 Å
Crystal structure of an intramolecular human telomeric dna g-quadruplex bound by the naphthalene diimide bmsg-sh-4
Collie, G.W. , Parkinson, G.N. , Promontorio, R.
Primary Citation of Related Structures: 3T5E
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| human telomeric DNA sequence | a | 22 | NA | AGGGTTAGGGTTAGGGTTAGGG |
Experimental Data
Method: X-RAY DIFFRACTION
Deposited Date: 2011-07-27 Deposition Author(s): Collie, G.W. , Parkinson, G.N. , Promontorio, R.