Nmr structure of the apob mrna stem-loop and its interaction with the c to u editing apobec1 complementary factor
PDB DOI: 10.2210/pdb1ync/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2005-01-24 Deposition Author(s): Allain, F.H. , Chester, A. , Maris, C. , Masse, J. , Navaratnam, N.
Nmr structure of the apob mrna stem-loop and its interaction with the c to u editing apobec1 complementary factor
Allain, F.H. , Chester, A. , Maris, C. , Masse, J. , Navaratnam, N.
Primary Citation of Related Structures: 1YNC
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| apolipoprotein B mRNA | a | 31 | NA | GGAUAUAUGAUACAAUUUGAUCAGUAUAUCC |
Method: SOLUTION NMR
Deposited Date: 2005-01-24 Deposition Author(s): Allain, F.H. , Chester, A. , Maris, C. , Masse, J. , Navaratnam, N.